Get a Virtool-style sequence document for the given accession.
The data is retrieved from GenBank and converted into a palatable format.
Status: 200 OK
{
"id": "KJ406323",
"definition": "Tobacco mosaic virus isolate TMV-tNK coat protein",
"sequence": "ATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGZ...",
"host": "Solanum lycopersicum"
}| Status | Message | Reason |
|---|---|---|
404 |
Not found | accession does not exist on Genbank |
502 |
Could not reach Genbank | the Virtool server could not connect to NCBI |