Genbank Updated May 3, 2022

Get

Get a Virtool-style sequence document for the given accession.

The data is retrieved from GenBank and converted into a palatable format.

GET /api/genbank/:accession

Example

GET /api/genbank/KJ406323

Response

Status: 200 OK

{
  "id": "KJ406323",
  "definition": "Tobacco mosaic virus isolate TMV-tNK coat protein",
  "sequence": "ATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGZ...",
  "host": "Solanum lycopersicum"
}

Errors

Status Message Reason
404 Not found accession does not exist on Genbank
502 Could not reach Genbank the Virtool server could not connect to NCBI
PAGE CONTENTS